Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250004

Morpholino Name: nodal1 MO3
Synonyms: Xnr-1 MO-3
mRNA Target: nodal1

Morpholino Type: uncategorized morpholino
Sequence:
5' CTTGCACTGCTGATCTCTCTTTCA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/24
genomic

MO
5' TGAAAGAGAGATCAGCAGTGCAAG 3' |||||||||||||||||||||||| 3' ACTTTCTCTCTAGTCGTCACGTTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold171831:210537..210560 24/24 Antisense target nodal1.L
Scaffold59267:2177673..2177696 23/24 Antisense off-target Xelaev16065126m
Scaffold325141:2225339..2225362 21/24 unknown
Scaffold124774:735735..735758 20/24 Sense off-target akirin2.S
Scaffold165627:1004282..1004305 20/24 unknown
Scaffold20345:677227..677250 20/24 unknown
Scaffold265107:4363657..4363680 20/24 Sense off-target nova1.L
Scaffold286644:309625..309648 20/24 Antisense off-target tmed4.S
Scaffold4321:9167332..9167355 20/24 Sense off-target Xelaev16053118m
Scaffold69258:1683653..1683676 20/24 Sense off-target Xelaev16068751m
Scaffold74488:753010..753033 20/24 Antisense off-target Xelaev16071233m
tropicalis 7.1 scaffold_1:31342215..31342238 20/24 unknown
scaffold_4:22720501..22720524 20/24 unknown
scaffold_7:49080982..49081005 20/24 unknown
scaffold_9:46023014..46023037 20/24 unknown
Publications
First: Xenopus nodal related-1 is indispensable only for left-right axis determination., Int J Dev Biol 2005                  
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556