Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250004

Morpholino Name: nodal1 MO3
Synonyms: Xnr-1 MO-3
Target mRNA: nodal1

Morpholino Type: uncategorized morpholino
Sequence: 5' CTTGCACTGCTGATCTCTCTTTCA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/24 23/24
genomic

MO
5' TGAAAGAGAGATCAGCAGTGCAAG 3' |||||||||||||||||||||||| 3' ACTTTCTCTCTAGTCGTCACGTTC 5' 5' TGGAAGAGAGATCAGCAGTGCAAG 3' || ||||||||||||||||||||| 3' ACTTTCTCTCTAGTCGTCACGTTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3L:125376043..125376066 24/24 Antisense target nodal1.L
chr3S:20865496..20865519 23/24 Antisense target nodal1.S
chr3L:125376043..125376066 24/24 Sense off-target star.L
chr4L:81543674..81543697 21/24 Sense off-target LOC108714277
Scaffold22:2852788..2852811 20/24 Antisense off-target cdipt.L
chr9_10S:58047183..58047206 20/24 Sense off-target csrnp3.S
chr5S:69370133..69370156 20/24 Sense off-target akirin2.S
chr6L:72725648..72725671 20/24 Sense off-target LOC108718513 [provisional:dnah5]
chr8L:89866820..89866843 20/24 Sense off-target nova1.L
chr1L:74584122..74584145 20/24 unknown
chr3S:25770420..25770443 20/24 unknown
chr9_10S:68139141..68139164 20/24 unknown
tropicalis 10.0 Chr1:175322898..175322921 20/24 unknown
Chr4:50664142..50664165 20/24 unknown
Chr7:52175630..52175653 20/24 unknown
Chr9:58479542..58479565 20/24 unknown
Publications
First: Xenopus nodal related-1 is indispensable only for left-right axis determination., Int J Dev Biol 2005                  
Most recent:
View All Papers