Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250005

Morpholino Name: nodal1 MO4
Synonyms: Xnr-1 MO-2, Xnr-1 MO2
mRNA Target: nodal1

Morpholino Type: uncategorized morpholino
Sequence:
5' ACAGATAATTTACTCACTTTTTGCA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' TGCAAAAAGTGAGTATATTATCTGT 3' ||||||||||||||| ||||||||| 3' ACGTTTTTCACTCATTTAATAGACA 5' 5' TGCAAAAAGTGAGTAAATTATCTGT 3' ||||||||||||||||||||||||| 3' ACGTTTTTCACTCATTTAATAGACA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold171831:210840..210864 25/25 Antisense target nodal1.L
Scaffold59267:2177976..2178000 23/25 Antisense off-target Xelaev16065126m
Scaffold102974:9299123..9299147 22/25 Antisense off-target Xelaev16000742m
Scaffold318577:1294204..1294228 21/25 unknown
tropicalis 7.1 scaffold_3:5677835..5677859 24/25 Antisense target nodal1
scaffold_1:143445622..143445646 21/25 unknown
scaffold_18:1177843..1177867 21/25 unknown
scaffold_4:93846850..93846874 21/25 Antisense off-target sgip1
scaffold_5:60679331..60679355 21/25 unknown
Publications
First: Xenopus nodal related-1 is indispensable only for left-right axis determination., Int J Dev Biol 2005                  
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556