Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250005

Morpholino Name: nodal1 MO4
Synonyms: Xnr-1 MO-2, Xnr-1 MO2
Target mRNA: nodal1

Morpholino Type: uncategorized morpholino
Sequence: 5' ACAGATAATTTACTCACTTTTTGCA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 23/25
genomic

MO
5' TGCAAAAAGTGAGTATATTATCTGT 3' ||||||||||||||| ||||||||| 3' ACGTTTTTCACTCATTTAATAGACA 5' 5' TGCAAAAAGTGAGTAAATTATCTGT 3' ||||||||||||||||||||||||| 3' ACGTTTTTCACTCATTTAATAGACA 5' 5' TGCAAAAAGTGAGTACATTATATGT 3' ||||||||||||||| ||||| ||| 3' ACGTTTTTCACTCATTTAATAGACA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3L:125376346..125376370 25/25 Antisense target nodal1.L
chr3S:20865192..20865216 23/25 Antisense target nodal1.S
chr3L:125376346..125376370 25/25 Sense off-target star.L
chr5L:12958572..12958596 22/25 Antisense off-target esrrg.L
chr9_10S:31885903..31885927 21/25 Sense off-target Xelaev18046648m
tropicalis 10.0 Chr3:132122985..132123009 24/25 Antisense target nodal1
Chr4:83886912..83886936 21/25 Antisense off-target sgip1
Chr5:47675276..47675300 21/25 Sense off-target crim1
Chr1:83531780..83531804 21/25 unknown
Publications
First: Xenopus nodal related-1 is indispensable only for left-right axis determination., Int J Dev Biol 2005                  
Most recent:
View All Papers