Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250006

Morpholino Name: nodal1 MO5
Synonyms: Xnr1 MO, Xnr1-MO
mRNA Target: nodal1

Morpholino Type: uncategorized morpholino
Sequence:
5' GCTGTCAGAAATGCCATGCTTGCAC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 22/25 25/25
genomic

MO
5' GCACAAGGATGGCATTTCTGACAGC 3' | |||| ||||||||||||||||| 3' CACGTTCGTACCGTAAAGACTGTCG 5' 5' GTGCAAGCATGGCATTTCTGACAGC 3' ||||||||||||||||||||||||| 3' CACGTTCGTACCGTAAAGACTGTCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold171831:210554..210578 25/25 Antisense target nodal1.L
Scaffold59267:2177690..2177714 25/25 Antisense off-target Xelaev16065126m
Scaffold390725:141..165 22/25 unknown
Scaffold3267:1215643..1215667 21/25 Sense off-target ttc30a.S
tropicalis 7.1 scaffold_3:5678112..5678136 22/25 Antisense target nodal1
scaffold_19:969674..969698 21/25 Antisense off-target kif14
scaffold_9:73198667..73198691 21/25 unknown
Publications
First: The left-right axis is regulated by the interplay of Coco, Xnr1 and derrière in Xenopus embryos., Dev Biol 2007                
Most recent: TGF-β Signaling Regulates the Differentiation of Motile Cilia., Cell Rep 2015                  
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.1


Major funding for Xenbase is provided by grant P41 HD064556