Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250007

Morpholino Name: nodal1 MO6
Synonyms: Xnr-1 MO3
mRNA Target: nodal1

Morpholino Type: uncategorized morpholino
Sequence:
5' CTTGCACTGCTGATCTCTCTTTCAG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CTGAAAGAGAGATCAGCAGTGCAAG 3' ||||||||||||||||||||||||| 3' GACTTTCTCTCTAGTCGTCACGTTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold171831:210536..210560 25/25 Antisense target nodal1.L
Scaffold59267:2177672..2177696 24/25 Antisense off-target Xelaev16065126m
Scaffold325141:2225339..2225363 22/25 unknown
Scaffold231412:31623..31647 21/25 Sense off-target Xelaev16030060m
tropicalis 7.1 scaffold_1:31342215..31342239 21/25 unknown
scaffold_2:11549905..11549929 21/25 unknown
scaffold_9:24127558..24127582 21/25 unknown
Publications
First: Xenopus nodal related-1 is indispensable only for left-right axis determination., Int J Dev Biol 2005                  
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.0


Major funding for Xenbase is provided by grant P41 HD064556