Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250007

Morpholino Name: nodal1 MO6
Synonyms: Xnr-1 MO3
Target mRNA: nodal1

Morpholino Type: uncategorized morpholino
Sequence: 5' CTTGCACTGCTGATCTCTCTTTCAG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25
genomic

MO
5' CTGAAAGAGAGATCAGCAGTGCAAG 3' ||||||||||||||||||||||||| 3' GACTTTCTCTCTAGTCGTCACGTTC 5' 5' CTGGAAGAGAGATCAGCAGTGCAAG 3' ||| ||||||||||||||||||||| 3' GACTTTCTCTCTAGTCGTCACGTTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3L:125376042..125376066 25/25 Antisense target nodal1.L
chr3S:20865496..20865520 24/25 Antisense target nodal1.S
chr3L:125376042..125376066 25/25 Sense off-target star.L
chr4L:81543674..81543698 22/25 Sense off-target LOC108714277
chr7S:34773381..34773405 21/25 Sense off-target psap.S
tropicalis 10.0 Chr2:88292863..88292887 21/25 Sense off-target csmd2
Chr1:175322897..175322921 21/25 unknown
Chr9:48867425..48867449 21/25 unknown
Publications
First: Xenopus nodal related-1 is indispensable only for left-right axis determination., Int J Dev Biol 2005                  
Most recent:
View All Papers