Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250008

Morpholino Name: nodal2 MO1
Synonyms: Xnr2 MOa
mRNA Target: nodal2

Morpholino Type: uncategorized morpholino
Sequence:
5' CTAGGCTTGCCATCTCTGGAGAG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/23
genomic

MO
5' CTCTCCAGAGATGGCAAGCCTAG 3' ||||||||||||||||||||||| 3' GAGAGGTCTCTACCGTTCGGATC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3L:125369981..125370003 23/23 Sense off-target star.L
chr3L:125369981..125370003 23/23 Antisense target nodal2.L
chr3S:20890235..20890257 23/23 Antisense off-target LOC108712674
chr3L:23352350..23352372 19/23 unknown
chr4L:118534898..118534920 19/23 unknown
tropicalis 10.0 Chr1:11632091..11632113 19/23 unknown
Chr10:20632379..20632401 19/23 unknown
Publications
First: Distinct Xenopus Nodal ligands sequentially induce mesendoderm and control gastrulation movements in parallel to the Wnt/PCP pathway., Development 2010            
Most recent:
View All Papers