Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250009

Morpholino Name: nodal2 MO2
Synonyms: Xnr2 MOb
mRNA Target: nodal2

Morpholino Type: uncategorized morpholino
Sequence:
5' CTGTATTGATTGTCTGACTCTTCCA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' TGGAAGAGTCAGACAATCAGTACAG 3' ||||||||||||||||||| ||||| 3' ACCTTCTCAGTCTGTTAGTTATGTC 5' 5' TGGAAGAGTCAGACAATCAATACAG 3' ||||||||||||||||||||||||| 3' ACCTTCTCAGTCTGTTAGTTATGTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3L:125369950..125369974 25/25 Sense off-target star.L
chr3L:125369950..125369974 25/25 Antisense target nodal2.L
chr2L:144316929..144316953 22/25 unknown
chr2S:56282701..56282725 21/25 Antisense off-target mdfi.S
chr3L:66718290..66718314 21/25 Sense off-target csmd1-a
chr4L:134880053..134880077 21/25 Antisense off-target camk1.L
chr5L:91178387..91178411 21/25 Sense off-target hcrtr2.L
chr6L:24180298..24180322 21/25 Antisense off-target LOC108718805
chr6L:84667046..84667070 21/25 unknown
chr6S:100068965..100068989 21/25 unknown
chr1L:198049536..198049560 21/25 unknown
chr1L:98978964..98978988 21/25 Antisense off-target rfx2.L
tropicalis 10.0 Chr3:132114789..132114813 24/25 Antisense target nodal2
Chr2:71065016..71065040 21/25 Antisense off-target mdfi
Publications
First: Distinct Xenopus Nodal ligands sequentially induce mesendoderm and control gastrulation movements in parallel to the Wnt/PCP pathway., Development 2010            
Most recent:
View All Papers