Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250010

Morpholino Name: nodal3.1 MO1
Synonyms: Xnr3, Xnr3 5 UTR
Target mRNA: nodal3.1

Morpholino Type: translation blocking morpholino (5' UTR)
Sequence: 5' CCAACTGAGGAGATGCTTCTTGTTCAGAC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 27/29 27/29
genomic

MO
5' CTCTGAACAAGAAGCATCTCCTCAGCTGG 3' |||||||||||||||||||||||| ||| 3' CAGACTTGTTCTTCGTAGAGGAGTCAACC 5' 5' CTCTGAACAAGAAGCATCTCCTCAGCTGG 3' |||||||||||||||||||||||| ||| 3' CAGACTTGTTCTTCGTAGAGGAGTCAACC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3L:125319527..125319555 27/29 Antisense target nodal3.1.L
chr3L:125319527..125319555 27/29 Sense off-target star.L
chr3L:125330402..125330430 27/29 Sense off-target star.L
chr3L:125330402..125330430 27/29 Antisense off-target nodal3.2.L
chr3L:125336956..125336984 27/29 Sense off-target star.L
chr3L:125336956..125336984 27/29 Antisense off-target LOC108711649
chr3L:125353552..125353580 26/29 Sense off-target star.L
chr3L:125343214..125343242 26/29 Sense off-target star.L
chr3L:125343214..125343242 26/29 Antisense off-target LOC108711650
chr3L:125348512..125348540 26/29 Sense off-target star.L
tropicalis 10.0 Chr3:132081081..132081109 27/29 Antisense target nodal3.1
Chr3:132086826..132086854 27/29 Antisense off-target LOC100491713
Chr3:132091529..132091557 27/29 Antisense off-target LOC100488935
Chr3:132095224..132095252 27/29 Antisense off-target LOC101732995
Chr3:132100141..132100169 27/29 Antisense off-target LOC101732995
Publications
First: A novel role for a nodal-related protein; Xnr3 regulates convergent extension movements via the FGF receptor., Development 2003      
Most recent:
View All Papers