Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250011

Morpholino Name: nodal5.2 MO1
Synonyms: Xnr5 MOa, Xnr5MO, xnr5, xnr5 MO
mRNA Target: nodal5.2

Morpholino Type: uncategorized morpholino
Sequence:
5' AGATAAAGCCTAGCACAGCCATATC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' GATATGGCTGTGCTATGCTTTATCT 3' ||||||||||||||| ||||||||| 3' CTATACCGACACGATCCGAAATAGA 5' 5' GATATGGCTGTGCTAGGCTTTATCT 3' ||||||||||||||||||||||||| 3' CTATACCGACACGATCCGAAATAGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold128772:900025..900049 25/25 Antisense target nodal5.2.L
Scaffold199789:93..117 24/25 unknown
Scaffold87341:471196..471220 21/25 unknown
tropicalis 7.1 scaffold_3:6955620..6955644 24/25 unknown
scaffold_3:6961471..6961495 24/25 Antisense target nodal5.2
scaffold_3:6967157..6967181 24/25 unknown
scaffold_3:6974283..6974307 24/25 Antisense off-target nodal5
scaffold_1:197726191..197726215 21/25 Sense off-target grk4
Publications
First: Distinct Xenopus Nodal ligands sequentially induce mesendoderm and control gastrulation movements in parallel to the Wnt/PCP pathway., Development 2010            
Most recent: Coco regulates dorsoventral specification of germ layers via inhibition of TGFβ signalling., Development 2013                
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556