Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250012

Morpholino Name: nodal5.2 MO2
Synonyms: Xnr5 MOb, xnr5 MO
mRNA Target: nodal5.2

Morpholino Type: uncategorized morpholino
Sequence:
5' CCATATCTGGAGAGGGAAGCTTCCA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 25/25
genomic

MO
5' TGGAAGCTTCATTCTCCAGATATGG 3' |||||||||| ||||||||||||| 3' ACCTTCGAAGGGAGAGGTCTATACC 5' 5' TGGAAGCTTCCCTCTCCAGATATGG 3' ||||||||||||||||||||||||| 3' ACCTTCGAAGGGAGAGGTCTATACC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold128772:900007..900031 25/25 Antisense target nodal5.2.L
Scaffold199789:75..99 24/25 unknown
Scaffold15229:56..80 23/25 unknown
Scaffold36401:3847513..3847537 21/25 Antisense off-target zwilch.S
tropicalis 7.1 scaffold_3:6961453..6961477 23/25 Antisense target nodal5.2
scaffold_3:6967139..6967163 23/25 unknown
scaffold_3:6974265..6974289 23/25 Antisense off-target nodal5
Publications
First: Distinct Xenopus Nodal ligands sequentially induce mesendoderm and control gastrulation movements in parallel to the Wnt/PCP pathway., Development 2010            
Most recent: An essential role for transcription before the MBT in Xenopus laevis., Dev Biol 2011          
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556