Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250012

Morpholino Name: nodal5.2 MO2
Synonyms: Xnr5 MOb, xnr5 MO
mRNA Target: nodal5.2

Morpholino Type: uncategorized morpholino
Sequence:
5' CCATATCTGGAGAGGGAAGCTTCCA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' TGGAAGCTTCCCTCTCCAGATATGG 3' ||||||||||||||||||||||||| 3' ACCTTCGAAGGGAGAGGTCTATACC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3L:124090037..124090061 25/25 Antisense target nodal5.2.L
chr3L:124060885..124060909 25/25 Antisense off-target LOC108711635
chr3L:124067286..124067310 25/25 Antisense off-target nodal5.L
chr3L:124084179..124084203 24/25 Antisense off-target nodal5.L
chr3L:124031834..124031858 23/25 Antisense off-target nodal5.8.L
chr3L:124039239..124039263 23/25 Antisense off-target nodal5.7.L
chr3L:124046878..124046902 23/25 Antisense off-target nodal5.6.L
chr3S:35796291..35796315 21/25 Antisense off-target zwilch.S
tropicalis 10.0 Chr3:130798095..130798119 23/25 Antisense off-target nodal5
Chr3:130811216..130811240 23/25 Antisense off-target LOC116409495
Chr3:130816907..130816931 23/25 Antisense off-target LOC101734231
Chr3:130807689..130807713 22/25 Antisense off-target LOC100490072
Publications
First: Distinct Xenopus Nodal ligands sequentially induce mesendoderm and control gastrulation movements in parallel to the Wnt/PCP pathway., Development 2010            
Most recent: An essential role for transcription before the MBT in Xenopus laevis., Dev Biol 2011          
View All Papers