Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250013

Morpholino Name: nodal6 MO1
Synonyms: Xnr6 MOa, Xnr6MO, xnr6, xnr6 MO
mRNA Target: nodal6

Morpholino Type: uncategorized morpholino
Sequence:
5' CAAGACTAAGTTCACTAGGGCCATC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' GATGGCCCTAGTGAACTTAGTCTTG 3' ||||||||||||||||||||||||| 3' CTACCGGGATCACTTGAATCAGAAC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold128772:888476..888500 25/25 Antisense target nodal6.L
tropicalis 7.1 scaffold_4:121063697..121063721 21/25 unknown
Publications
First: Distinct Xenopus Nodal ligands sequentially induce mesendoderm and control gastrulation movements in parallel to the Wnt/PCP pathway., Development 2010            
Most recent: Coco regulates dorsoventral specification of germ layers via inhibition of TGFβ signalling., Development 2013                
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556