Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250014

Morpholino Name: nodal6 MO2
Synonyms: Xnr6 MOb, xnr6 MO
mRNA Target: nodal6

Morpholino Type: uncategorized morpholino
Sequence:
5' TTCTCTTGGAGCTGGATCTTGTTCT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 24/25
genomic

MO
5' AGGACAAGATCCAGCTCCAAGAGAA 3' || |||||||||||||||||||||| 3' TCTTGTTCTAGGTCGAGGTTCTCTT 5' 5' AGAACAAGACCCAGCTCCAAGAGAA 3' ||||||||| ||||||||||||||| 3' TCTTGTTCTAGGTCGAGGTTCTCTT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold128772:888504..888528 24/25 Antisense target nodal6.L
Scaffold59267:1376124..1376148 24/25 Antisense target nodal6.S
Scaffold45765:126700..126724 21/25 Sense off-target Xelaev16055259m
Publications
First: Distinct Xenopus Nodal ligands sequentially induce mesendoderm and control gastrulation movements in parallel to the Wnt/PCP pathway., Development 2010            
Most recent: An essential role for transcription before the MBT in Xenopus laevis., Dev Biol 2011          
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556