Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250015

Morpholino Name: nog MO1
Synonyms: Nog MO, Nog-MO, Noggin, Noggin MO, Noggin-MO, Noggin1, Noggin1 MO, nMO
mRNA Target: nog

Morpholino Type: uncategorized morpholino
Sequence:
5' TCACAAGGCACTGGGAATGATCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' ATGGATCATTCCCAGTGCCTTGTGA 3' ||||||||||||||||||||||||| 3' TACCTAGTAAGGGTCACGGAACACT 5' 5' ATGGATCATTCCCAGTGCCTTGTGA 3' ||||||||||||||||||||||||| 3' TACCTAGTAAGGGTCACGGAACACT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold100342:355661..355685 25/25 Antisense off-target Xelaev16000189m
Scaffold373158:1037650..1037674 25/25 Antisense target nog.L
Scaffold120511:1371332..1371356 22/25 unknown
tropicalis 7.1 scaffold_10:15223219..15223243 25/25 Antisense target nog
Publications
First: Dkk1 and noggin cooperate in mammalian head induction., Genes Dev 2003  
Most recent: Novel functions of Noggin proteins: inhibition of Activin/Nodal and Wnt signaling., Development 2011                
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556