Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250016

Morpholino Name: nog2 MO1
Synonyms: Noggin2, Noggin2 MO
mRNA Target: nog2

Morpholino Type:
Sequence:
5' CCTCAGGCAGATTTATCCTCTTCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' ATGAAGAGGATAAATCTGCCTGAGG 3' ||||||||||||||||||||||||| 3' TACTTCTCCTATTTAGACGGACTCC 5' 5' ATGAAGAGGATAAATCTGCCTGAGG 3' ||||||||||||||||||||||||| 3' TACTTCTCCTATTTAGACGGACTCC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold23403:4692255..4692279 25/25 Antisense off-target Xelaev16030910m
Scaffold939:2122940..2122964 25/25 Antisense target nog2.L
Scaffold39730:448124..448148 21/25 Sense off-target Xelaev16051058m
Scaffold403228:94845..94869 21/25 unknown
Scaffold49179:585364..585388 21/25 Sense off-target Xelaev16057837m
tropicalis 7.1 scaffold_9:77715411..77715435 25/25 Antisense target nog2
Publications
First: Novel functions of Noggin proteins: inhibition of Activin/Nodal and Wnt signaling. [Development 2011]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.8.1
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556