Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250018

Morpholino Name: notch1 MO1
Synonyms: Notch Mo, Notch1 MO, Xotch Mo
mRNA Target: notch1

Morpholino Type: uncategorized morpholino
Sequence:
5' GCACAGCCAGCCCTATCCGATCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25
genomic

MO
5' ATGGATCGGATAGGACTGGCTGTGC 3' |||||||||||||| |||||||||| 3' TACCTAGCCTATCCCGACCGACACG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold46073:729366..729390 24/25 Antisense target notch1.S
Scaffold37448:2581819..2581843 23/25 unknown
Scaffold16424:437354..437378 21/25 Antisense off-target Xelaev16018604m
tropicalis 7.1 scaffold_34:183693..183717 21/25 unknown
Publications
First: Notch activates sonic hedgehog and both are involved in the specification of dorsal midline cell-fates in Xenopus., Development 2003        
Most recent: Notch1 is asymmetrically distributed from the beginning of embryogenesis and controls the ventral center., Development 2018                            
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.1


Major funding for Xenbase is provided by grant P41 HD064556