Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250020

Morpholino Name: npnt MO1
Synonyms: npnt translation-blocking morpholino
mRNA Target: npnt

Morpholino Type: uncategorized morpholino
Sequence:
5' TATTAACCTGATTGCTAACTCCATG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CATGGAGTTAGCAATCAGGTTAATA 3' ||||||||||||||||||||||||| 3' GTACCTCAATCGTTAGTCCAATTAT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold90624:1553..1577 23/25 unknown
Scaffold243:4231150..4231174 22/25 Antisense off-target Xelaev16032338m
Scaffold24467:4117796..4117820 22/25 Sense off-target Xelaev16032567m
Scaffold8129:4481680..4481704 21/25 unknown
Scaffold9994:1136055..1136079 21/25 unknown
tropicalis 7.1 scaffold_1:148663522..148663546 25/25 Antisense target npnt
scaffold_4:55621722..55621746 21/25 Sense off-target muc5ac
scaffold_7:9900464..9900488 21/25 Sense off-target tmem26
Publications
First: The secreted integrin ligand nephronectin is necessary for forelimb formation in Xenopus tropicalis., Dev Biol 2011                                  
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556