Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250030

Morpholino Name: ntrk2 MO2
Synonyms: TrkB, anti-xTrkB, anti-xTrkB morpholino, xTrkB
Target mRNA: ntrk2

Morpholino Type: uncategorized morpholino
Sequence: 5' CCACTGGATCCCCCCTAGAATGGAG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr6L:104072332..104072356 21/25 Sense off-target rab31.L
chr7L:45243581..45243605 21/25 unknown
Publications
First: Rapid BDNF-induced retrograde synaptic modification in a developing retinotectal system., Nature 2004  
Most recent: Postsynaptic TRPC1 function contributes to BDNF-induced synaptic potentiation at the developing neuromuscular junction., J Neurosci 2011                  
View All Papers