Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250038

Morpholino Name: odc1 MO1
Synonyms: xODC mo
mRNA Target: odc1

Morpholino Type:
Sequence:
5' AGTCGTCATTGCTGAAGCTGTTCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' ATGAACAGCTTCAGCAACGACGACT 3' ||||||||||||||||| ||||||| 3' TACTTGTCGAAGTCGTTACTGCTGA 5' 5' ATGAACAGCTTCAGCAATGACGACT 3' ||||||||||||||||||||||||| 3' TACTTGTCGAAGTCGTTACTGCTGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold142445:3740765..3740789 25/25 Antisense target odc1.L
Scaffold149890:4775393..4775417 24/25 Antisense off-target Xelaev16014720m
Scaffold58517:3151496..3151520 22/25 Sense off-target Xelaev16063944m
tropicalis 7.1 scaffold_5:25749595..25749619 24/25 Antisense target odc1
scaffold_8:104028138..104028162 22/25 unknown
Publications
First: Antiapoptotic role for ornithine decarboxylase during oocyte maturation. [Mol Cell Biol 2009]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.1
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556