Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250038

Morpholino Name: odc1 MO1
Synonyms: xODC mo
mRNA Target: odc1

Morpholino Type: uncategorized morpholino
Sequence:
5' AGTCGTCATTGCTGAAGCTGTTCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25 24/25
genomic

MO
5' ATGAACAGCTTCAGCAACGACGACT 3' ||||||||||||||||| ||||||| 3' TACTTGTCGAAGTCGTTACTGCTGA 5' 5' ATGAACAGCTTCAGCAATGACGACT 3' ||||||||||||||||||||||||| 3' TACTTGTCGAAGTCGTTACTGCTGA 5' 5' ATGAACGGCTTCAGCAATGACGACT 3' |||||| |||||||||||||||||| 3' TACTTGTCGAAGTCGTTACTGCTGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr5L:138350431..138350455 25/25 Antisense target odc1.L
chr5S:119391349..119391373 24/25 Antisense target odc1.S
chr5L:109268005..109268029 22/25 Sense off-target golim4.L
tropicalis 10.0 Chr5:138457099..138457123 24/25 Antisense target odc1
Chr8:125959331..125959355 22/25 Antisense off-target LOC100490829
Chr8:125959331..125959355 22/25 Antisense off-target LOC100489750
Chr8:125959331..125959355 22/25 Antisense off-target LOC100489659
Publications
First: Antiapoptotic role for ornithine decarboxylase during oocyte maturation., Mol Cell Biol 2009  
Most recent:
View All Papers