Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250041

Morpholino Name: olfml3 MO1
Synonyms: ONT1 MO
mRNA Target: olfml3

Morpholino Type:
Sequence:
5' AGGCCACAATCCCAGCCATCATTGG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' CCAACGATGGCTGGGATTGTGGCCT 3' |||| |||||||||||||||||||| 3' GGTTACTACCGACCCTAACACCGGA 5' 5' CCAATGATGGCTGGGATTGTGGCCT 3' ||||||||||||||||||||||||| 3' GGTTACTACCGACCCTAACACCGGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold35524:117930-117954 25/25 Antisense off-target Xelaev16046482m
Scaffold47533:6846831-6846855 25/25 Antisense target olfml3.L
tropicalis 7.1 scaffold_1:74771499-74771523 24/25 Antisense target olfml3
scaffold_9:56334555-56334579 21/25 Antisense off-target tjp1
Publications
First: Robust stability of the embryonic axial pattern requires a secreted scaffold for chordin degradation. [Cell 2008]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556