Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250042

Morpholino Name: olfml3 MO2
Synonyms: ONT1 MO2
Target mRNA: olfml3

Morpholino Type: uncategorized morpholino
Sequence: 5' GCTCACTGCTTTGGAATGCTTGGCC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' GGCCAAGCATTCCAAAGCAGTGAGC 3' ||||||||||||||||||||||||| 3' CCGGTTCGTAAGGTTTCGTCACTCG 5' 5' GGCCAAGCATTCCAAAGCAGTGAGC 3' ||||||||||||||||||||||||| 3' CCGGTTCGTAAGGTTTCGTCACTCG 5' 5' GGCCAAGCATTCCAAAGCAGTGAGC 3' ||||||||||||||||||||||||| 3' CCGGTTCGTAAGGTTTCGTCACTCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr2L:54063730..54063754 25/25 Antisense target olfml3.L
chr2S:43362723..43362747 25/25 Antisense target olfml3.S
chr8L:3579027..3579051 21/25 Antisense off-target LOC108699510
tropicalis 10.0 Chr2:54432270..54432294 25/25 Antisense target olfml3
Chr9:22696076..22696100 22/25 Sense off-target cog7
Chr8:5768589..5768613 21/25 Antisense off-target LOC100493904
Publications
First: Robust stability of the embryonic axial pattern requires a secreted scaffold for chordin degradation., Cell 2008                    
Most recent:
View All Papers