Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250042

Morpholino Name: olfml3 MO2
Synonyms: ONT1 MO2
mRNA Target: olfml3

Morpholino Type:
Sequence:
5' GCTCACTGCTTTGGAATGCTTGGCC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' GGCCAAGCATTCCAAAGCAGTGAGC 3' ||||||||||||||||||||||||| 3' CCGGTTCGTAAGGTTTCGTCACTCG 5' 5' GGCCAAGCATTCCAAAGCAGTGAGC 3' ||||||||||||||||||||||||| 3' CCGGTTCGTAAGGTTTCGTCACTCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold35524:118068..118092 25/25 Antisense off-target Xelaev16046482m
Scaffold47533:6846972..6846996 25/25 Antisense target olfml3.L
Scaffold37448:1938231..1938255 21/25 Antisense off-target Xelaev16048874m
tropicalis 7.1 scaffold_1:74771637..74771661 25/25 Antisense target olfml3
scaffold_9:77101837..77101861 22/25 Sense off-target cog7
scaffold_418:45909..45933 21/25 unknown
Publications
First: Robust stability of the embryonic axial pattern requires a secreted scaffold for chordin degradation. [Cell 2008]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.1
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556