Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250043

Morpholino Name: orc2 MO1
Synonyms:
mRNA Target: orc2

Morpholino Type:
Sequence:
5' GAGCTTCATGGCTCATGTTTGACGT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 25/25
genomic

MO
5' AAGTCAAACATGAGCCATGAATCTC 3' | ||||||||||||||||||| ||| 3' TGCAGTTTGTACTCGGTACTTCGAG 5' 5' ACGTCAAACATGAGCCATGAAGCTC 3' ||||||||||||||||||||||||| 3' TGCAGTTTGTACTCGGTACTTCGAG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold20345:3536000-3536024 25/25 Antisense target orc2.S
tropicalis 7.1 scaffold_9:31260645-31260669 23/25 Antisense target orc2
scaffold_19:543001-543025 22/25 unknown
scaffold_232:83901-83925 21/25 unknown
scaffold_9:22142899-22142923 21/25 unknown
Publications
First: The midblastula transition defines the onset of Y RNA-dependent DNA replication in Xenopus laevis. [Mol Cell Biol 2011]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556