Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250044

Morpholino Name: orc2 MO2
Synonyms:
mRNA Target: orc2

Morpholino Type:
Sequence:
5' TACCTCCCGCAAAACTTTGAACCGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25
genomic

MO
5' GCGGTTCAAAGTTTTGCGGGAGGTG 3' |||||||||||||||||||||||| 3' CGCCAAGTTTCAAAACGCCCTCCAT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold20345:3535073-3535097 24/25 Antisense target orc2.S
Scaffold13523:5719371-5719395 21/25 Antisense off-target arih2.L
Scaffold36134:2677847-2677871 21/25 Antisense off-target Xelaev16047093m
tropicalis 7.1 scaffold_2:81150729-81150753 21/25 Antisense off-target rab5b
scaffold_7:71679945-71679969 21/25 Antisense off-target pafah1b2
scaffold_8:44829521-44829545 21/25 Antisense off-target prrc2a
Publications
First: The midblastula transition defines the onset of Y RNA-dependent DNA replication in Xenopus laevis. [Mol Cell Biol 2011]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556