Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250045

Morpholino Name: osr1 MO1
Synonyms: MOXOsr1
mRNA Target: osr1

Morpholino Type:
Sequence:
5' TGCTGGAAGGGTCTTGCTCCCCATC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25
genomic

MO
5' GATGGGGAGCAAGACCCTTCCAGCC 3' |||||||||||||||||||||||| 3' CTACCCCTCGTTCTGGGAAGGTCGT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold149890:742824-742848 24/25 Antisense off-target Xelaev16014666m
Scaffold93416:2811044-2811068 24/25 Antisense off-target Xelaev16079001m
tropicalis 7.1 scaffold_3636:1413-1437 24/25 Antisense target osr1
Publications
First: Odd-skipped genes encode repressors that control kidney development. [Dev Biol 2007]
Most recent: Suppression of Bmp4 signaling by the zinc-finger repressors Osr1 and Osr2 is required for Wnt/β-catenin-mediated lung specification in Xenopus. [Development 2012]
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556