Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250046

Morpholino Name: osr2 MO1
Synonyms: MOXOsr2
mRNA Target: osr2

Morpholino Type:
Sequence:
5' GGCTGGAAGAGCTTTGCTGCCCATT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 24/25 24/25
genomic

MO
5' AATGGGCAGCAAAGCGCTTCCAGCC 3' ||||||||||||||| ||||||||| 3' TTACCCGTCGTTTCGAGAAGGTCGG 5' 5' GATGGGCAGCAAAGCTCTTCCAGCC 3' |||||||||||||||||||||||| 3' TTACCCGTCGTTTCGAGAAGGTCGG 5' 5' GATGGGCAGCAAAGCTCTTCCAGCC 3' |||||||||||||||||||||||| 3' TTACCCGTCGTTTCGAGAAGGTCGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold34503:2922610-2922634 24/25 Antisense target osr2.S
Scaffold62229:1362271-1362295 24/25 Antisense target osr2.L
Scaffold18892:5541104-5541128 21/25 unknown
Scaffold227943:8692-8716 21/25 unknown
Scaffold29621:3279271-3279295 21/25 Antisense off-target Xelaev16039662m
Scaffold7842:150-174 21/25 unknown
Scaffold85591:700457-700481 21/25 Antisense off-target mib1.L
tropicalis 7.1 scaffold_6:20974833-20974857 24/25 Antisense target osr2
Publications
First: Odd-skipped genes encode repressors that control kidney development. [Dev Biol 2007]
Most recent: Suppression of Bmp4 signaling by the zinc-finger repressors Osr1 and Osr2 is required for Wnt/β-catenin-mediated lung specification in Xenopus. [Development 2012]
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556