Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250047

Morpholino Name: otx2 MO1
Synonyms: Otx2, Otx2-MO
Target mRNA: otx2

Morpholino Type: uncategorized morpholino
Sequence: 5' GGTTGCTTGAGATAAGACATCATGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' GCATGATGTCTTATCTCAAGCAACC 3' ||||||||||||||||||||||||| 3' CGTACTACAGAATAGAGTTCGTTGG 5' 5' GCATGATGTCTTATCTCAAGCAACC 3' ||||||||||||||||||||||||| 3' CGTACTACAGAATAGAGTTCGTTGG 5' 5' GCATGATGTCTTATCTCAAGCAACC 3' ||||||||||||||||||||||||| 3' CGTACTACAGAATAGAGTTCGTTGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8L:81101019..81101043 25/25 Antisense target otx2.L
chr8S:6437118..6437142 25/25 Antisense target otx2.S
tropicalis 10.0 Chr8:104117786..104117810 25/25 Antisense target otx2
Chr6:100147766..100147790 21/25 Antisense off-target dipk1c
Publications
First: Antagonistic interaction between IGF and Wnt/JNK signaling in convergent extension in Xenopus embryo., Mech Dev 2005                  
Most recent: Morpholinos Do Not Elicit an Innate Immune Response during Early Xenopus Embryogenesis., Dev Cell 2019          
View All Papers