Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250047

Morpholino Name: otx2 MO1
Synonyms: Otx2, Otx2-MO
mRNA Target: otx2

Morpholino Type: uncategorized morpholino
Sequence:
5' GGTTGCTTGAGATAAGACATCATGC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' GCATGATGTCTTATCTCAAGCAACC 3' ||||||||||||||||||||||||| 3' CGTACTACAGAATAGAGTTCGTTGG 5' 5' GCATGATGTCTTATCTCAAGCAACC 3' ||||||||||||||||||||||||| 3' CGTACTACAGAATAGAGTTCGTTGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold133644:1772018..1772042 25/25 Antisense off-target Xelaev16009780m
Scaffold91950:415489..415513 25/25 Antisense target otx2.L
tropicalis 7.1 scaffold_8:83088502..83088526 25/25 Antisense target otx2
scaffold_6:50734767..50734791 21/25 Antisense off-target fam69c
Publications
First: Antagonistic interaction between IGF and Wnt/JNK signaling in convergent extension in Xenopus embryo., Mech Dev 2005                  
Most recent: A gene regulatory network controlling hhex transcription in the anterior endoderm of the organizer., Dev Biol 2011                              
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556