Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250048

Morpholino Name: otx2 MO2
Synonyms: 32E7.2moA
Target mRNA: otx2

Morpholino Type: uncategorized morpholino
Sequence: 5' GCGGTTGCTTGAGATAAGACATCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genomic

MO
5' ATGATGTCTTATCTCAAGCAACCGC 3' ||||||||||||||||||||||||| 3' TACTACAGAATAGAGTTCGTTGGCG 5' 5' ATGATGTCTTATCTCAAGCAACCGC 3' ||||||||||||||||||||||||| 3' TACTACAGAATAGAGTTCGTTGGCG 5' 5' ATGATGTCTTATCTCAAGCAACCGC 3' ||||||||||||||||||||||||| 3' TACTACAGAATAGAGTTCGTTGGCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr8L:81101021..81101045 25/25 Antisense target otx2.L
chr8S:6437116..6437140 25/25 Antisense target otx2.S
tropicalis 10.0 Chr8:104117788..104117812 25/25 Antisense target otx2
Chr3:83835429..83835453 21/25 Sense off-target itih5
Publications
First: Pilot morpholino screen in Xenopus tropicalis identifies a novel gene involved in head development., Dev Dyn 2004          
Most recent:
View All Papers