Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250048

Morpholino Name: otx2 MO2
Synonyms: 32E7.2moA
mRNA Target: otx2

Morpholino Type: uncategorized morpholino
Sequence:
5' GCGGTTGCTTGAGATAAGACATCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' ATGATGTCTTATCTCAAGCAACCGC 3' ||||||||||||||||||||||||| 3' TACTACAGAATAGAGTTCGTTGGCG 5' 5' ATGATGTCTTATCTCAAGCAACCGC 3' ||||||||||||||||||||||||| 3' TACTACAGAATAGAGTTCGTTGGCG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold133644:1772020..1772044 25/25 Antisense off-target Xelaev16009780m
Scaffold91950:415491..415515 25/25 Antisense target otx2.L
tropicalis 7.1 scaffold_8:83088504..83088528 25/25 Antisense target otx2
scaffold_3:112261607..112261631 21/25 Sense off-target itih5
Publications
First: Pilot morpholino screen in Xenopus tropicalis identifies a novel gene involved in head development., Dev Dyn 2004          
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556