Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250049

Morpholino Name: p2rx1 MO1
Synonyms: Xint-MO
mRNA Target: p2rx1

Morpholino Type: uncategorized morpholino
Sequence:
5' ATATTCCCCTTACCTATTAGACCT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 21/24
genomic

MO
5' AGATCTAATAGGTAAGGGGAAAAA 3' || |||||||||||||||||| | 3' TCCAGATTATCCATTCCCCTTATA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1S:52612906..52612929 22/24 Antisense off-target intu.S
chr1S:84033011..84033034 20/24 Antisense off-target ap1m1.S
chr4S:118896297..118896320 20/24 Antisense off-target ptprg.S
chr9_10S:23646327..23646350 20/24 Antisense off-target aspscr1.S
tropicalis 10.0 Chr2:101656729..101656752 21/24 Antisense target p2rx1
Chr6:26945840..26945863 20/24 Sense off-target trnan-guu
Publications
First: Ciliogenesis defects in embryos lacking inturned or fuzzy function are associated with failure of planar cell polarity and Hedgehog signaling., Nat Genet 2006  
Most recent: Dishevelled controls apical docking and planar polarization of basal bodies in ciliated epithelial cells., Nat Genet 2008        
View All Papers