Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250049

Morpholino Name: p2rx1 MO1
Synonyms: Xint-MO
mRNA Target: p2rx1

Morpholino Type:
Sequence:
5' ATATTCCCCTTACCTATTAGACCT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 21/24
genomic

MO
5' AGATCTAATAGGTAAGGGGAAAAA 3' || |||||||||||||||||| | 3' TCCAGATTATCCATTCCCCTTATA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold68717:175547..175570 22/24 Antisense off-target intu.S
Scaffold122810:197227..197250 20/24 Antisense off-target aspscr1.S
Scaffold34527:6509771..6509794 20/24 Antisense off-target Xelaev16045394m
Scaffold54274:1093095..1093118 20/24 Antisense off-target ap1m1.S
tropicalis 7.1 scaffold_2:37028873..37028896 21/24 Antisense target p2rx1
scaffold_6:118540976..118540999 20/24 unknown
Publications
First: Ciliogenesis defects in embryos lacking inturned or fuzzy function are associated with failure of planar cell polarity and Hedgehog signaling. [Nat Genet 2006]
Most recent: Dishevelled controls apical docking and planar polarization of basal bodies in ciliated epithelial cells. [Nat Genet 2008]
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.1
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556