Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250050

Morpholino Name: p2ry11 MO1
Synonyms: P2Y11-MO
mRNA Target: p2ry11

Morpholino Type: uncategorized morpholino
Sequence:
5' GCAGACGGAGGAAGCCATTTATTCT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 25/25
genomic

MO
5' AGAATAAATGGCTTCCTCCAACTGC 3' ||||||||||||||||||| |||| 3' TCTTATTTACCGAAGGAGGCAGACG 5' 5' AGAATAAATGGCTTCCTCCGTCTGC 3' ||||||||||||||||||||||||| 3' TCTTATTTACCGAAGGAGGCAGACG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr3L:130300567..130300591 25/25 Antisense target p2ry11.L
chr9_10L:13958194..13958218 21/25 Antisense off-target pck1.L
tropicalis 10.0 Chr3:137084949..137084973 23/25 Antisense target p2ry11
Chr8:129184077..129184101 21/25 Antisense off-target anp32e
Publications
First: Tissue-Tissue Interaction-Triggered Calcium Elevation Is Required for Cell Polarization during Xenopus Gastrulation., PLoS One 2010                
Most recent:
View All Papers