Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250050

Morpholino Name: p2ry11 MO1
Synonyms: P2Y11-MO
mRNA Target: p2ry11

Morpholino Type:
Sequence:
5' GCAGACGGAGGAAGCCATTTATTCT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 23/25 25/25
genomic

MO
5' AGAATAAATGGCTTCCTCCAACTGC 3' ||||||||||||||||||| |||| 3' TCTTATTTACCGAAGGAGGCAGACG 5' 5' AGAATAAATGGCTTCCTCCGTCTGC 3' ||||||||||||||||||||||||| 3' TCTTATTTACCGAAGGAGGCAGACG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold18726:1856203-1856227 25/25 Antisense target p2ry11.L
Scaffold13471:2411981-2412005 21/25 Antisense off-target Xelaev16010152m
tropicalis 7.1 scaffold_18:598568-598592 23/25 Antisense target p2ry11
scaffold_8:105430588-105430612 21/25 Antisense off-target anp32e
Publications
First: Tissue-Tissue Interaction-Triggered Calcium Elevation Is Required for Cell Polarization during Xenopus Gastrulation. [PLoS One 2010]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556