Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250051

Morpholino Name: pabpc1 MO1
Synonyms: PABP1-B, PABP1-B (AUG)
mRNA Target: pabpc1

Morpholino Type:
Sequence:
5' GGTAGCTGGGAGCACTGGGATTCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' ATGAATCCAAGTGCTCCCAGCTACC 3' |||||||| |||||||||||||||| 3' TACTTAGGGTCACGAGGGTCGATGG 5' 5' ATGAATCCCAGTGCTCCCAGCTACC 3' ||||||||||||||||||||||||| 3' TACTTAGGGTCACGAGGGTCGATGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold34503:771154..771178 25/25 Antisense target pabpc1.S
Scaffold150977:19213..19237 21/25 Antisense off-target orc5.L
Scaffold90484:2657424..2657448 21/25 unknown
Scaffold98999:5257786..5257810 21/25 unknown
tropicalis 7.1 scaffold_6:19123683..19123707 24/25 Antisense target pabpc1
scaffold_4:34561417..34561441 21/25 unknown
Publications
First: Poly(A)-binding proteins are functionally distinct and have essential roles during vertebrate development. [Proc Natl Acad Sci U S A 2011]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.1
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556