Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250056

Morpholino Name: pacrg MO1
Synonyms: parcg MO
mRNA Target: pacrg

Morpholino Type:
Sequence:
5' TGCTTGTCTCAAACACCATATTCAC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold45174:1736517..1736541 25/25 unknown
Scaffold121003:571256..571280 23/25 unknown
Scaffold146478:228370..228394 22/25 unknown
Scaffold130324:1695530..1695554 21/25 unknown
tropicalis 7.1 scaffold_336:32174..32198 22/25 unknown
Publications
First: Ciliary and non-ciliary expression and function of PACRG during vertebrate development. [Cilia 2012]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.2
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556