Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250064

Morpholino Name: pax2 MO2
Synonyms: pax2-specific morpholino2
mRNA Target: pax2

Morpholino Type: translation blocking morpholino (ATG)
Sequence:
5' GGTCTGCCTTGCAGTGCATATCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' ATGGATATGCACTGCAAGGCAGATC 3' ||||||||||||||||||||||| | 3' TACCTATACGTGACGTTCCGTCTGG 5' 5' ATGGATATGCACTGCAAGGCAGACC 3' ||||||||||||||||||||||||| 3' TACCTATACGTGACGTTCCGTCTGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold16807:3742638..3742662 25/25 Antisense target pax2.L
Scaffold10944:1274371..1274395 24/25 Antisense off-target Xelaev16002418m
Scaffold13265:1658732..1658756 22/25 unknown
Scaffold63529:838084..838108 21/25 unknown
Scaffold8355:4380500..4380524 21/25 Sense off-target Xelaev16075571m
tropicalis 7.1 scaffold_7:42665873..42665897 24/25 Antisense target pax2
scaffold_9:68401555..68401579 21/25 unknown
Publications
First: En2, Pax2/5 and Tcf-4 transcription factors cooperate in patterning the Xenopus brain., Dev Biol 2010                    
Most recent: Frizzled 3 acts upstream of Alcam during embryonic eye development., Dev Biol 2017                          
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.3


Major funding for Xenbase is provided by grant P41 HD064556