Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250065

Morpholino Name: pax3 MO1
Synonyms: PAX3MO, Pax3, Pax3 MO, Pax3-MO
mRNA Target: pax3

Morpholino Type: translation blocking morpholino (5' UTR)
Sequence:
5' TCTCAGTTCCCTTGCCAAGTATTAA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' TTAATACTTGGCAAGGGAACTGAGA 3' ||||||||||||||||||||||||| 3' AATTATGAACCGTTCCCTTGACTCT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold16807:11335011..11335035 25/25 Antisense target pax3.S
Scaffold200825:1515426..1515450 22/25 Antisense off-target Xelaev16025441m
Publications
First: Msx1 and Pax3 cooperate to mediate FGF8 and WNT signals during Xenopus neural crest induction., Dev Cell 2005              
Most recent: A gene regulatory network underlying the formation of pre-placodal ectoderm in Xenopus laevis., BMC Biol 2018                              
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556