Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250067

Morpholino Name: pax3 MO3
Synonyms: Pax3B MO, Pax3B-MO
mRNA Target: pax3

Morpholino Type: translation blocking morpholino (5' UTR)
Sequence:
5' TTCCCTTACAAAGAACTAAATCCAA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' TTGGATTTAGTTCTTTGTAAGGGAA 3' ||||||||||||||||||||||||| 3' AACCTAAATCAAGAAACATTCCCTT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold294828:230984..231008 25/25 Antisense target pax3.L
Scaffold115601:57119..57143 21/25 unknown
Scaffold126618:10296..10320 21/25 unknown
Scaffold160841:3950303..3950327 21/25 Antisense off-target cmss1.L
Scaffold265107:4533673..4533697 21/25 unknown
Scaffold41091:89239..89263 21/25 unknown
Scaffold8129:546326..546350 21/25 unknown
tropicalis 7.1 scaffold_1:12565909..12565933 21/25 Antisense off-target fech
scaffold_6:33256271..33256295 21/25 Sense off-target tox
Publications
First: Neural crest determination by co-activation of Pax3 and Zic1 genes in Xenopus ectoderm., Development 2005            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.13.1
Major funding for Xenbase is provided by grant P41 HD064556