Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250069

Morpholino Name: pax5 MO1
Synonyms: pax5-specific morpholino
mRNA Target: pax5

Morpholino Type: uncategorized morpholino
Sequence:
5' GGTCGTGCTTACAGTGTATTTCCAT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' ATGGAAATACACTGTAAGCACGACC 3' ||||||||||||||||||||||||| 3' TACCTTTATGTGACATTCGTGCTGG 5' 5' ATGGAAATACACTGTAAGCACGACC 3' ||||||||||||||||||||||||| 3' TACCTTTATGTGACATTCGTGCTGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 Scaffold21:5056505..5056529 25/25 Antisense off-target LOC108703726 [provisional:pax5]
chr1L:106869233..106869257 25/25 Antisense target pax5.L
chr4S:62450402..62450426 21/25 unknown
tropicalis 10.0 Chr1:109328566..109328590 25/25 Antisense target pax5
Chr6:112082502..112082526 21/25 unknown
Publications
First: En2, Pax2/5 and Tcf-4 transcription factors cooperate in patterning the Xenopus brain., Dev Biol 2010                    
Most recent:
View All Papers