Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250070

Morpholino Name: pax6 MO1
Synonyms: Pax6
mRNA Target: pax6

Morpholino Type: uncategorized morpholino
Sequence:
5' GCTGTGACTGTTCTGCATGTCGAG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr4L:61145935..61145958 20/24 Antisense off-target c16orf87.L
chr4L:61157824..61157847 20/24 Antisense off-target c16orf87.L
chr1S:134929018..134929041 21/24 unknown
tropicalis 10.0 Chr1:51549591..51549614 20/24 Sense off-target marchf1
Publications
First: Retinal patterning by Pax6-dependent cell adhesion molecules., Dev Neurobiol 2010                  
Most recent: Using the Xenopus Developmental Eye Regrowth System to Distinguish the Role of Developmental Versus Regenerative Mechanisms., Front Physiol 2019                  
View All Papers