Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250072

Morpholino Name: pax7 MO2
Synonyms: Pax7MO ( translation blocking )
mRNA Target: pax7

Morpholino Type: uncategorized morpholino
Sequence:
5' TGGGATAAATGAAGACCTACCTTCC 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold374693:371696..371720 24/25 Antisense off-target Xelaev16048942m
Scaffold195950:1396450..1396474 22/25 Antisense off-target Xelaev16024796m
Scaffold42960:5465886..5465910 21/25 unknown
Scaffold52352:1694704..1694728 21/25 Antisense off-target Xelaev16059978m
Scaffold7479:3068552..3068576 21/25 unknown
Publications
First: The Pax3 and Pax7 paralogs cooperate in neural and neural crest patterning using distinct molecular mechanisms, in Xenopus laevis embryos., Dev Biol 2010                                                    
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556