Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250074

Morpholino Name: pcbp3 MO1
Synonyms: hnRNP E MO
mRNA Target: pcbp3

Morpholino Type: uncategorized morpholino
Sequence:
5' GGCTATTGTCAGAAGCTGTACAAAG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25
genomic

MO
5' CTTTGTACAGCTTCTGACAATAGCC 3' ||||||||||||||||||||||||| 3' GAAACATGTCGAAGACTGTTATCGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold49342:686410..686434 25/25 Antisense off-target Xelaev16057917m
Scaffold5732:7642298..7642322 25/25 Antisense off-target Xelaev16063189m
Scaffold139741:1386709..1386733 21/25 Antisense off-target Xelaev16012434m
tropicalis 7.1 scaffold_2:91078015..91078039 25/25 Antisense target pcbp3
Publications
First: A crucial role for hnRNP K in axon development in Xenopus laevis., Development 2008                  
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.1


Major funding for Xenbase is provided by grant P41 HD064556