Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250087

Morpholino Name: pdgfa MO1
Synonyms: Anti-PDGFA, PDGF-A morpholino, PDGFA, xPDGF
Target mRNA: pdgfa

Morpholino Type: uncategorized morpholino
Sequence: 5' AGAATCCAAGCCCAGATCCTCATTG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25 25/25
genomic

MO
5' CAATGAGGATCTGGGCTTGGATTCT 3' ||||||||||||||||||||||||| 3' GTTACTCCTAGACCCGAACCTAAGA 5' 5' CAATGAGGATCTGGGCTCGGATTCT 3' ||||||||||||||||| ||||||| 3' GTTACTCCTAGACCCGAACCTAAGA 5' 5' CAATGAGGATCTGGGCTTGGATTCT 3' ||||||||||||||||||||||||| 3' GTTACTCCTAGACCCGAACCTAAGA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr9_10S:87865120..87865144 25/25 Antisense target pdgfa.S
chr9_10L:97950929..97950953 24/25 Antisense target pdgfa.L
tropicalis 10.0 Chr9:27898633..27898657 25/25 Antisense target pdgfa
Publications
First: Guidance of mesoderm cell migration in the Xenopus gastrula requires PDGF signaling., Development 2004      
Most recent: Capillarity and active cell movement at mesendoderm translocation in the Xenopus gastrula., Development 2021  
View All Papers