Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250090

Morpholino Name: pdzk1ip1 MO1
Synonyms: XPteg MO
mRNA Target: pdzk1ip1

Morpholino Type: uncategorized morpholino
Sequence:
5' GCAGGGAGAACATAGTTGCAAAGAG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 21/25 25/25
genomic

MO
5' CTATCGGCAACTATGTTATCCCTGC 3' || | ||||||||||| ||||||| 3' GAGAAACGTTGATACAAGAGGGACG 5' 5' CTCTTTGCAACTATGTTCTCCCTGC 3' ||||||||||||||||||||||||| 3' GAGAAACGTTGATACAAGAGGGACG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold69443:2549778..2549802 25/25 Antisense target pdzk1ip1.S
Scaffold276272:1824752..1824776 23/25 Antisense off-target Xelaev16038006m
Scaffold23301:5082267..5082291 21/25 unknown
Scaffold311950:214295..214319 21/25 unknown
Scaffold3490:1851772..1851796 21/25 Antisense off-target scpep1.L
Scaffold43061:4740132..4740156 21/25 unknown
tropicalis 7.1 scaffold_1:48859684..48859708 21/25 unknown
scaffold_3:69209597..69209621 21/25 unknown
scaffold_4:103787973..103787997 21/25 Antisense target pdzk1ip1
Publications
First: XPteg (Xenopus proximal tubules-expressed gene) is essential for pronephric mesoderm specification and tubulogenesis., Mech Dev 2010                    
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556