Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250092

Morpholino Name: pfn1 MO1
Synonyms: XProfilin, XProfilin1
mRNA Target: pfn1

Morpholino Type: uncategorized morpholino
Sequence:
5' TGTAGCCGTTCCAAGACATTGTTGT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities
genomic

MO
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold113187:799160..799184 24/25 Antisense off-target Xelaev16003652m
Scaffold183929:469076..469100 21/25 unknown
Publications
First: Profilin is an effector for Daam1 in non-canonical Wnt signaling and is required for vertebrate gastrulation., Development 2006    
Most recent: Non-redundant roles for Profilin2 and Profilin1 during vertebrate gastrulation., Dev Biol 2009            
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556