Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250093

Morpholino Name: pfn2 MO1
Synonyms: XProfilin2
mRNA Target: pfn2

Morpholino Type: uncategorized morpholino
Sequence:
5' CGCACTGAAGATGTCCGGCTGGCAG 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 25/25
genomic

MO
5' CTGCCAGCCGGACATCTTCAGTGCG 3' ||||||||||||||||||||||||| 3' GACGGTCGGCCTGTAGAAGTCACGC 5' 5' CTGCCAGCCGGACATCTTCAGTGCG 3' ||||||||||||||||||||||||| 3' GACGGTCGGCCTGTAGAAGTCACGC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 7.1 Scaffold172068:2830636..2830660 25/25 Sense target pfn2.L
Scaffold82102:4158943..4158967 25/25 Sense off-target Xelaev16075163m
Scaffold307846:1547195..1547219 21/25 Antisense off-target Xelaev16041608m
Scaffold48253:1802338..1802362 21/25 unknown
tropicalis 7.1 scaffold_5:22607133..22607157 25/25 Sense target pfn2
Publications
First: Non-redundant roles for Profilin2 and Profilin1 during vertebrate gastrulation., Dev Biol 2009            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556