Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250096

Morpholino Name: pias4 MO1
Synonyms: XPIASy
Target mRNA: pias4

Morpholino Type: uncategorized morpholino
Sequence: 5' TCGCCTCCACTAACTCCGCCGCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 25/25 24/25
genomic

MO
5' ATGGCGGCGGAGCTGGTGGAGGCGA 3' |||||||||||| | |||||||||| 3' TACCGCCGCCTCAATCACCTCCGCT 5' 5' ATGGCGGCGGAGTTAGTGGAGGCGA 3' ||||||||||||||||||||||||| 3' TACCGCCGCCTCAATCACCTCCGCT 5' 5' ATGGCGGCGGAGCTAGTGGAGGCGA 3' |||||||||||| |||||||||||| 3' TACCGCCGCCTCAATCACCTCCGCT 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1L:88828688..88828712 25/25 Antisense target pias4.L
chr1S:77956847..77956871 24/25 Antisense target pias4.S
chr1S:77956847..77956871 24/25 Sense off-target Xelaev18009639m
chr9_10L:9772236..9772260 21/25 Sense off-target sulf2.L
tropicalis 10.0 Chr1:93078878..93078902 23/25 Antisense target pias4
Publications
First: Negative regulation of Smad2 by PIASy is required for proper Xenopus mesoderm formation., Development 2004                                  
Most recent:
View All Papers