Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250097

Morpholino Name: pias4 MO2
Synonyms: XPIASy
Target mRNA: pias4

Morpholino Type: uncategorized morpholino
Sequence: 5' CCGCCATCTTGGCTTCCAGCGTCCC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 24/25
genomic

MO
5' GGGACGCTGGAAGCCAAGATGGCGG 3' ||||||||||||||||||||||||| 3' CCCTGCGACCTTCGGTTCTACCGCC 5' 5' GGGACGCTGGAAGCCAAGATGGCGG 3' ||||||||||||||||||||||||| 3' CCCTGCGACCTTCGGTTCTACCGCC 5' 5' GGGACGCTGGAAGCCAAAATGGCGG 3' ||||||||||||||||| ||||||| 3' CCCTGCGACCTTCGGTTCTACCGCC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1L:88828706..88828730 25/25 Antisense target pias4.L
chr1S:77956865..77956889 24/25 Antisense target pias4.S
chr1S:77956865..77956889 24/25 Sense off-target Xelaev18009639m
chr9_10L:2195979..2196003 21/25 Sense off-target erbb2.L
chr2L:81182537..81182561 21/25 unknown
tropicalis 10.0 Chr1:93078896..93078920 25/25 Antisense target pias4
Chr6:104470575..104470599 22/25 Antisense off-target ndufv2
Chr8:119788511..119788535 22/25 Sense off-target fut8
Chr4:89746157..89746181 22/25 Antisense off-target st3gal3
Chr5:72439353..72439377 22/25 Antisense off-target gja1
Chr6:70116223..70116247 21/25 Sense off-target dap
Chr9:30985777..30985801 21/25 Sense off-target mad1l1
Chr8:56237406..56237430 22/25 unknown
Chr2:160934137..160934161 22/25 unknown
Chr1:150863389..150863413 21/25 unknown
Chr1:5994717..5994741 21/25 unknown
Chr3:78422721..78422745 21/25 unknown
Publications
First: Negative regulation of Smad2 by PIASy is required for proper Xenopus mesoderm formation., Development 2004                                  
Most recent:
View All Papers