Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250102

Morpholino Name: pkd2 MO1
Synonyms: Pkd2-MO
Target mRNA: pkd2

Morpholino Type: uncategorized morpholino
Sequence: 5' GGTTTGATTCTGCTGGGATTCATCG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 21/25 25/25
genomic

MO
5' TCATGATTCCCAGCAGAATAAAACC 3' |||| |||||||||||| ||||| 3' GCTACTTAGGGTCGTCTTAGTTTGG 5' 5' CGATGAATCCCAGCAGAATCAAACC 3' ||||||||||||||||||||||||| 3' GCTACTTAGGGTCGTCTTAGTTTGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1L:73578540..73578564 25/25 Antisense target pkd2.L
tropicalis 10.0 Chr1:79263931..79263955 21/25 Antisense target pkd2
Publications
First: The RNA-binding protein bicaudal C regulates polycystin 2 in the kidney by antagonizing miR-17 activity., Development 2010                
Most recent: An Early Function of Polycystin-2 for Left-Right Organizer Induction in Xenopus., iScience 2018                                          
View All Papers