Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250105

Morpholino Name: plcg1 MO1
Synonyms: XPLC 1-MO, XPLCg1 MO
Target mRNA: plcg1

Morpholino Type: uncategorized morpholino
Sequence: 5' CTGCTCCTGCTGTAAATCCACCAAG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25
genomic

MO
5' CTTGGTGGATGTACAGCAGGAGCAG 3' |||||||||| |||||||||||||| 3' GAACCACCTAAATGTCGTCCTCGTC 5' 5' CTTGGTGGATTTACAGCAGGAGCAG 3' ||||||||||||||||||||||||| 3' GAACCACCTAAATGTCGTCCTCGTC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 Scaffold94:45002..45026 25/25 Antisense target plcg1.S
chr9_10L:32349032..32349056 24/25 Antisense target plcg1.L
chr2L:125288745..125288769 21/25 unknown
tropicalis 10.0 Chr9:25387428..25387452 22/25 Antisense off-target cyth3
Chr4:111657866..111657890 21/25 Antisense off-target nr5a2
Chr5:128933671..128933695 21/25 Antisense off-target LOC100489252
Publications
First: Competition for ligands between FGFR1 and FGFR4 regulates Xenopus neural development., Int J Dev Biol 2010            
Most recent:
View All Papers