Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250107

Morpholino Name: plxna1 MO2
Synonyms: PlexinA1
mRNA Target: plxna1

Morpholino Type: uncategorized morpholino
Sequence:
5' GGCCTCTCGGCGTGGAGCAGCATCT 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 24/25 25/25 22/25
genomic

MO
5' AGATGCTGCTCCACGCCGAGAAGCC 3' ||||||||||||||||||||| ||| 3' TCTACGACGAGGTGCGGCTCTCCGG 5' 5' AGATGCTGCTCCACGCCGAGAGGCC 3' ||||||||||||||||||||||||| 3' TCTACGACGAGGTGCGGCTCTCCGG 5' 5' AGATGCTGCTCCATGCCGGGAAGCC 3' ||||||||||||| |||| || ||| 3' TCTACGACGAGGTGCGGCTCTCCGG 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr4L:128853960..128853984 25/25 Antisense target plxna1.L
chr4S:106901748..106901772 22/25 Antisense target plxna1.S
tropicalis 10.0 Chr4:134283810..134283834 24/25 Antisense target plxna1
Publications
First: PlexinA1 interacts with PTK7 and is required for neural crest migration., Biochem Biophys Res Commun 2010            
Most recent:
View All Papers