Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250110

Morpholino Name: pnhd MO1
Synonyms: 25H12.1moC
Target mRNA: pnhd

Morpholino Type: uncategorized morpholino
Sequence: 5' ACCAAGAAAAGATGTTCCATGTCTG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 24/25 24/25
genomic

MO
5' CAGACATGGAACATCTTTTCTTGGT 3' ||||||||||||||||||||||||| 3' GTCTGTACCTTGTAGAAAAGAACCA 5' 5' CAGACATGGAACATCTTTTCTTGTT 3' ||||||||||||||||||||||| | 3' GTCTGTACCTTGTAGAAAAGAACCA 5' 5' CAGACATGGCACATCTTTTCTTGGT 3' ||||||||| ||||||||||||||| 3' GTCTGTACCTTGTAGAAAAGAACCA 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1L:101958834..101958858 24/25 Antisense target pnhd.L
chr1S:89990488..89990512 24/25 Antisense target pnhd.S
chr1L:212610657..212610681 21/25 unknown
chr9_10L:9211225..9211249 21/25 unknown
tropicalis 10.0 Chr1:104459700..104459724 25/25 Antisense target pnhd
Chr1:104459700..104459724 25/25 Sense off-target LOC116412038
Chr10:37388264..37388288 21/25 Antisense off-target eya2
Chr3:83749072..83749096 21/25 unknown
Publications
First: Pilot morpholino screen in Xenopus tropicalis identifies a novel gene involved in head development., Dev Dyn 2004          
Most recent:
View All Papers