Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki
XB-MORPHOLINO-17250111

Morpholino Name: pnhd MO2
Synonyms: 25H12.1moB
mRNA Target: pnhd

Morpholino Type: uncategorized morpholino
Sequence:
5' CCTGTTCATCACGCTATCATCTAAA 3'

Source: Gene Tools LLC


mRNA Target tropicalis laevis.L laevis.S
Identities 25/25 24/25
genomic

MO
5' TTTAGATGATAGCGTGATGAACAGG 3' ||||||||||||||||||||||||| 3' AAATCTACTATCGCACTACTTGTCC 5' 5' TTTAGATGGTAGCGTGATGAACAGG 3' |||||||| |||||||||||||||| 3' AAATCTACTATCGCACTACTTGTCC 5'
Genomic Alignments Position Identity Strand Target mRNA
laevis 9.2 chr1L:101959092..101959116 24/25 Antisense target pnhd.L
tropicalis 10.0 Chr1:104459943..104459967 25/25 Antisense target pnhd
Chr1:104459943..104459967 25/25 Sense off-target LOC116412038
Publications
First: Pilot morpholino screen in Xenopus tropicalis identifies a novel gene involved in head development., Dev Dyn 2004          
Most recent:
View All Papers